D9Mit8 Primer Detail MGI Mouse MGI:705906

D9Mit8 Primer Detail

Name

D9Mit8
Primer 1 Sequence

GATGAAGACAATAAAGAACCTTAAA
Primer 2 Sequence

AAGAGCTAACCCATTGCTGC
ID

MGI:705906
Product Size

183
Other IDs

D9Mit8 (BROAD)
Note

MIT assay: M211
Additional information: MIT STS Marker Data Files

D9Mit8

DNA segment, Chr 9, Massachusetts Institute of Technology 8

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit8	c	smaller	C3HeB/FeJLe
	D9Mit8	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit8	a	178bp	LP/J
	b	180bp	CAST/EiJ
	c	185bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	193bp	AKR/J, BALB/cJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	e	195bp	A/J
	f	210bp	SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit8	l	larger	LG/J
	D9Mit8	s	smaller	SM/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24