D9Mit18 Primer Detail MGI Mouse MGI:705941

D9Mit18 Primer Detail

Name

D9Mit18
Primer 1 Sequence

TCACTGTAGCCCAGAGCAGT
Primer 2 Sequence

CCTGTTGTCAACACCTGATG
ID

MGI:705941
Product Size

180
Other IDs

D9Mit18 (BROAD)
Note

MIT assay: M10
Additional information: MIT STS Marker Data Files

D9Mit18

DNA segment, Chr 9, Massachusetts Institute of Technology 18

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit18	b	smaller	C57BL/6J
	D9Mit18	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit18	a	180bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, SPRET/EiJ
	b	204bp	AKR/J, DBA/2J, NON/ShiLt
	c	210bp	A/J, C3H/HeJ, CAST/EiJ
	d	213bp	BALB/cJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit18	l	larger	LG/J
	D9Mit18	s	smaller	SM/J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit18	c	upper	CBA/Kw
	D9Mit18	e	lower	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24