D17Mit88 Primer Detail MGI Mouse MGI:705944

D17Mit88 Primer Detail

Name

D17Mit88
Primer 1 Sequence

TGGCCTCTGTAGGCATCAG
Primer 2 Sequence

TGCTATGTAGCAAGTTAGAGGCC
ID

MGI:705944
Product Size

245
Other IDs

D17Mit88 (BROAD)
Note

MIT assay: D693
Additional information: MIT STS Marker Data Files

D17Mit88

DNA segment, Chr 17, Massachusetts Institute of Technology 88

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit88	a	170bp	SPRET/EiJ
	b	186bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
	c	236bp	NOD/MrkTac
	d	242bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit88	a	242bp	129/SvW, BN/aW, C57BL/6W, C57BL/10W
	D17Mit88	b	186bp	A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13