D17Mit81 Primer Detail MGI Mouse MGI:705953

D17Mit81 Primer Detail

Name

D17Mit81
Primer 1 Sequence

CAATCTATCTCATATGCATCTCTGTG
Primer 2 Sequence

GTCTGGTGCACCTGTCCTC
ID

MGI:705953
Product Size

125
Other IDs

D17Mit81 (BROAD)
Note

MIT assay: MMH169
Additional information: MIT STS Marker Data Files

D17Mit81

DNA segment, Chr 17, Massachusetts Institute of Technology 81

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit81	a	102bp	CAST/EiJ
	b	106bp	BALB/cJ, C57BL/6J
	c	114bp	NOD/MrkTac
	d	118bp	SPRET/EiJ
	e	124bp	C3H/HeJ, DBA/2J, LP/J
	f	126bp	A/J, B6.Cg-Lep^ob/+
	g	132bp	AKR/J, NON/ShiLt

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D17Mit81	c	smaller	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit81	c	105bp	CBA/CaOlaHsd
	D17Mit81	s	123bp	SWR/OlaHsd

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit81	c	tripple band	CBA/Kw
	D17Mit81	e	single band	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24