About   Help   FAQ
D17Mit81 Primer Detail
Primers
  • Name
    D17Mit81
  • Primer 1 Sequence
    CAATCTATCTCATATGCATCTCTGTG
  • Primer 2 Sequence
    GTCTGGTGCACCTGTCCTC
  • ID
    MGI:705953
  • Product Size
    125
  • Other IDs
    D17Mit81 (BROAD)
  • Note
    MIT assay: MMH169
    Additional information: MIT STS Marker Data Files
Genes
D17Mit81 DNA segment, Chr 17, Massachusetts Institute of Technology 81
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit81 a 102bp CAST/EiJ
b 106bp BALB/cJ, C57BL/6J
c 114bp NOD/MrkTac
d 118bp SPRET/EiJ
e 124bp C3H/HeJ, DBA/2J, LP/J
f 126bp A/J, B6.Cg-Lepob/+
g 132bp AKR/J, NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D17Mit81 c smaller C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit81 c 105bp CBA/CaOlaHsd
s 123bp SWR/OlaHsd
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D17Mit81 c tripple band CBA/Kw
e single band KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory