About   Help   FAQ
D13Mit9 Primer Detail
Primers
  • Name
    D13Mit9
  • Primer 1 Sequence
    GGGTTCCAGATTGAGTGGAA
  • Primer 2 Sequence
    TTGCCAAAGTGTCAAAATCA
  • ID
    MGI:705957
  • Product Size
    125
  • Other IDs
    D13Mit9 (BROAD)
  • Note
    MIT assay: M147
    Additional information: MIT STS Marker Data Files
Genes
D13Mit9 DNA segment, Chr 13, Massachusetts Institute of Technology 9
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit9 m 150bp MOLF/EiJ
s 140bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit9 a 116bp CAST/EiJ
b 126bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NON/ShiLt
c 132bp SPRET/EiJ
d 145bp C3H/HeJ, DBA/2J, NOD/MrkTac
J:61322 Montgomery JC, et al., MGI Direct Data Submission. 2000;
Endonuclease Gene Allele Fragments Strains
D13Mit9 a 120bp AEJ/Gn
s 132bp M. spretus
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D13Mit9 l smaller LG/J
s larger SM/J
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:61322 Montgomery JC, et al., Chromosomal localization of the mouse G protein-coupled receptor kinase 5 and 6 genes. MGI Direct Data Submission. 2000;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
08/02/2024
MGI 6.24 		The Jackson Laboratory