D13Mit8 Primer Detail MGI Mouse MGI:705958

D13Mit8 Primer Detail

Name

D13Mit8
Primer 1 Sequence

GCCCCATTTCTGAAGTTTCA
Primer 2 Sequence

AATAGACTCTTCAGCCCCCC
ID

MGI:705958
Product Size

190
Note

MIT assay: M61

D13Mit8

DNA segment, Chr 13, Massachusetts Institute of Technology 8

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit8	m	165bp	MOLF/EiJ
Not Specified	D13Mit8	s	182bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit8	a	182bp	AKR/J, C3H/HeJ, LP/J
	b	184bp	NOD/MrkTac
	c	190bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, NON/ShiLt
	d	200bp	CAST/EiJ
	e	250bp	SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit8	l	smaller	LG/J
	D13Mit8	s	larger	SM/J

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24