D13Mit3 Primer Detail MGI Mouse MGI:705960

D13Mit3 Primer Detail

Name

D13Mit3
Primer 1 Sequence

TCAGGCTCATCCCAGATACC
Primer 2 Sequence

TTTTGCAGAGAACACACACC
ID

MGI:705960
Product Size

162
Other IDs

D13Mit3 (BROAD)
Note

MIT assay: M79
Additional information: MIT STS Marker Data Files

D13Mit3

DNA segment, Chr 13, Massachusetts Institute of Technology 3

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit3	a	196bp	129X1/Sv
Not Specified	D13Mit3	f	164, 188bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D13Mit3	b	smallest	C57BL/6J
	c	196bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit3	m	270bp	MOLF/EiJ
Not Specified	D13Mit3	s	173bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit3	a	159bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	163bp	LP/J
	c	164bp	AKR/J, NOD/MrkTac
	d	178bp	SPRET/EiJ
	e	188bp	A/J, BALB/cJ, NON/ShiLt
	f	196bp	C3H/HeJ, CAST/EiJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D13Mit3	a	196bp	C3H/W, C57BL/10W, CBA/W, DBA/2W
	b	188bp	A.CA/W, BALB/cW
	c	164bp	AKR/W
	d	159bp	BN/aW, C57BL/6W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit3	c	larger	CBA/Kw
	D13Mit3	e	smaller	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24