D3Mit17 Primer Detail MGI Mouse MGI:705976

D3Mit17 Primer Detail

Name

D3Mit17
Primer 1 Sequence

CATGGCTCCATGGTTCTTG
Primer 2 Sequence

CCACGGAGAACAACTGAAGA
ID

MGI:705976
Product Size

198
Other IDs

D3Mit17 (BROAD)
Note

MIT assay: M235
Additional information: MIT STS Marker Data Files

D3Mit17

DNA segment, Chr 3, Massachusetts Institute of Technology 17

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D3Mit17	b	not given	C57BL/6J
	c	180bp	C3HeB/FeJLe
	f	smallest	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit17	a	180bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
	b	188bp	LP/J
	c	200bp	CAST/EiJ
	d	208bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24