About   Help   FAQ
D2Mit343 Primer Detail
Primers
  • Name
    D2Mit343
  • Primer 1 Sequence
    GTGTGTATTGGGGTACATGGG
  • Primer 2 Sequence
    GATGGTTCTTGAGGAACACTCC
  • ID
    MGI:705986
  • Product Size
    148
  • Other IDs
    D2Mit343 (BROAD)
  • Note
    MIT assay: MT2210
    Additional information: MIT STS Marker Data Files
Genes
D2Mit343 DNA segment, Chr 2, Massachusetts Institute of Technology 343
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit343 a 116bp SPRET/EiJ
b 129bp CAST/EiJ
c 151bp B6.Cg-Lepob/+
d 173bp A/J, AKR/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
e 176bp BALB/cJ
f 183bp C57BL/6J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit343 c 184bp CBA/CaOlaHsd
s 189bp SWR/OlaHsd
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D2Mit343 c lower CBA/Kw
k upper KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory