About   Help   FAQ
D10Mit117 Primer Detail
Primers
  • Name
    D10Mit117
  • Primer 1 Sequence
    ACTTCCACACATGAGTCATAGCA
  • Primer 2 Sequence
    CCAGTTGTCTTTCTTGGTTTTG
  • ID
    MGI:705997
  • Product Size
    124
  • Other IDs
    D10Mit117 (BROAD)
  • Note
    MIT assay: MMH330
    Additional information: MIT STS Marker Data Files
Genes
D10Mit117 DNA segment, Chr 10, Massachusetts Institute of Technology 117
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit117 b 0.142kb C57BL/6
c 0.126kb B10.BR-H2k, BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit117 a 110bp CAST/EiJ
b 124bp B6.Cg-Lepob/+, LP/J
c 126bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
d 130bp A/J, SPRET/EiJ
e 142bp C57BL/6J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D10Mit117 c larger C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit117 c 134bp CBA/CaOlaHsd
s 133bp SWR/OlaHsd
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory