D10Mit115 Primer Detail MGI Mouse MGI:705999

D10Mit115 Primer Detail

Name

D10Mit115
Primer 1 Sequence

CCATGGAATAGAAGTCTTTAAGAAGC
Primer 2 Sequence

ACCTGAAGGATAAAGGGTCTTACC
ID

MGI:705999
Product Size

126
Other IDs

D10Mit115 (BROAD)
Note

MIT assay: MT704
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 115

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit115	c	143bp	C3HeB/FeJLe
	D10Mit115	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit115	a	121bp	C57BL/6J
	b	127bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, DBA/2J, LP/J, NON/ShiLt
	c	129bp	NOD/MrkTac
	d	140bp	CAST/EiJ
	e	143bp	C3H/HeJ
	f	152bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit115	a	143bp	BN/aW, C3H/W, CBA/W
	D10Mit115	b	127bp	129/SvW, A.CA/W, AKR/W, BALB/cW, C57BL/6W, C57BL/10W, DBA/2W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24