About   Help   FAQ
D2Ucl1-pA, D2Ucl1-pB Primer Detail
Primers
  • Name
    D2Ucl1-pA, D2Ucl1-pB
  • Primer 1 Sequence
    CATGGAGGCATATCCCCAAC
  • Primer 2 Sequence
    TAGCAGGGCAGCAACAGCAC
  • ID
    MGI:706
  • Product Size
    206bp
Genes
D2Ucl1 DNA segment, Chr 2, Univeristy College London 1
Polymorphisms
J:17235 Abbott C, et al., Genomics. 1994 Mar 1;20(1):94-8
Endonuclease Gene Allele Fragments Strains
D2Ucl1 c 216bp C3H/HeH
s 190bp M. spretus
J:31804 Malas S, et al., Mamm Genome. 1996 Feb;7(2):145-8
Endonuclease Gene Allele Fragments Strains
D2Ucl1 a smaller AKR, C3H, C57BL/6, DBA
c larger CAST
s smallest M. spretus
References
J:17235 Abbott C, et al., Linkage mapping around the ragged (Ra) and wasted (wst) loci on distal mouse chromosome 2. Genomics. 1994 Mar 1;20(1):94-8
J:31804 Malas S, et al., The isolation and mapping of PCR markers specific to mouse Chromosome 2. Mamm Genome. 1996 Feb;7(2):145-8
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory