D18Mit87 Primer Detail MGI Mouse MGI:706015

D18Mit87 Primer Detail

Name

D18Mit87
Primer 1 Sequence

TATTAAAAGTTCATTTGTGCATGTACA
Primer 2 Sequence

ACTGGGAAAAGTACCACTGTAAGG
ID

MGI:706015
Product Size

144
Other IDs

D18Mit87 (BROAD)
Note

MIT assay: MT218
Additional information: MIT STS Marker Data Files

D18Mit87

DNA segment, Chr 18, Massachusetts Institute of Technology 87

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit87	m	148bp	MOLF/EiJ
Not Specified	D18Mit87	s	161bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit87	a	138bp	AKR/J, NON/ShiLt, SPRET/EiJ
	b	140bp	BALB/cJ, C3H/HeJ, NOD/MrkTac
	c	144bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	152bp	A/J, DBA/2J
	e	154bp	LP/J
	f	176bp	CAST/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24