D4Mit62 Primer Detail MGI Mouse MGI:706021

D4Mit62 Primer Detail

Name

D4Mit62
Primer 1 Sequence

TCCTCTGCCAGCTCTCTCTG
Primer 2 Sequence

CTGCAAGGAGGTGATGTTCA
ID

MGI:706021
Product Size

191
Note

MIT assay: MPC675

D4Mit62

DNA segment, Chr 4, Massachusetts Institute of Technology 62

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit62	a	170bp	AKR/J, NOD/MrkTac, NON/ShiLt
	b	186bp	DBA/2J
	c	190bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J
	d	210bp	CAST/EiJ, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D4Mit62	a	190bp	129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W
	b	186bp	BN/aW, DBA/2W
	c	170bp	AKR/W, C3H/W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13