D10Mit103 Primer Detail MGI Mouse MGI:706073

D10Mit103 Primer Detail

Name

D10Mit103
Primer 1 Sequence

TATGCCGACAATATTTCATTGC
Primer 2 Sequence

GCCTCTGCATACATACCAATACC
ID

MGI:706073
Product Size

139
Other IDs

D10Mit103 (BROAD)
Note

MIT assay: MPC2540
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 103

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit103	a	142bp	129X1/Sv
Not Specified	D10Mit103	f	142, 146bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit103	c	144bp	C3HeB/FeJLe
	D10Mit103	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit103	a	126bp	CAST/EiJ
	b	134bp	SPRET/EiJ
	c	140bp	LP/J
	d	142bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	e	144bp	C3H/HeJ, NON/ShiLt
	f	146bp	A/J, BALB/cJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24