D2Mit238 Primer Detail MGI Mouse MGI:706116

D2Mit238 Primer Detail

Name

D2Mit238
Primer 1 Sequence

ACCATCATTTTTGAACTCCACC
Primer 2 Sequence

ACGCATATGCTCAGGACACA
ID

MGI:706116
Product Size

134
Other IDs

D2Mit238 (BROAD)
Note

MIT assay: MT2174
Additional information: MIT STS Marker Data Files

D2Mit238

DNA segment, Chr 2, Massachusetts Institute of Technology 238

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit238	a	109bp	SPRET/EiJ
	b	129bp	AKR/J, CAST/EiJ
	c	135bp	B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
	d	153bp	A/J, DBA/2J, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D2Mit238	a	153bp	A.CA/W, BN/aW, DBA/2W
	b	135bp	129/SvW, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	c	129bp	AKR/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24