DXMit117 Primer Detail MGI Mouse MGI:706131

DXMit117 Primer Detail

Name

DXMit117
Primer 1 Sequence

GTAAAACCGCACTGACTAAGCC
Primer 2 Sequence

TTCGCCTCTATCTTACTCTGGC
ID

MGI:706131
Product Size

122
Other IDs

DXMit117 (BROAD)
Note

MIT assay: MT2293
Additional information: MIT STS Marker Data Files

DXMit117

DNA segment, Chr X, Massachusetts Institute of Technology 117

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit117	a	126bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J
	b	137bp	CAST/EiJ
	c	143bp	AKR/J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit117	a	143bp	AKR/W, DBA/2W
	DXMit117	b	126bp	129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit117	c	smaller	CBA/Kw
	DXMit117	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24