D5Mit23 Primer Detail MGI Mouse MGI:706142

D5Mit23 Primer Detail

Name

D5Mit23
Primer 1 Sequence

GCGGATTTCTGTAAGTTTAAGACT
Primer 2 Sequence

ATGATACCAATATACCCCTTCTCC
ID

MGI:706142
Product Size

194
Note

MIT assay: B362

D5Mit23

DNA segment, Chr 5, Massachusetts Institute of Technology 23

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit23	a	196bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv, 129X1/Sv
		b	192bp	129X1/SvJ
		c	180, 196bp	CD-1
		f	180, 194bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit23	a	180bp	C3H/HeJ, NON/ShiLt
	b	184bp	CAST/EiJ
	c	194bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	d	196bp	AKR/J, NOD/MrkTac
	e	198bp	DBA/2J, LP/J
	f	208bp	SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit23	c	upper	CBA/Kw
	D5Mit23	e	lower	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24