D5Mit24 Primer Detail MGI Mouse MGI:706143

D5Mit24 Primer Detail

Name

D5Mit24
Primer 1 Sequence

CACTTGCCACACAGCAGG
Primer 2 Sequence

CGTGCATGCACTAGTGTGTG
ID

MGI:706143
Product Size

174
Other IDs

D5Mit24 (BROAD)
Note

MIT assay: A632
Additional information: MIT STS Marker Data Files

D5Mit24

DNA segment, Chr 5, Massachusetts Institute of Technology 24

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit24	b	smaller	C57BL/6J
	D5Mit24	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit24	a	168bp	A/J
	b	174bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	184bp	DBA/2J
	d	186bp	CAST/EiJ
	e	190bp	AKR/J, LP/J
	f	196bp	C3H/HeJ, NON/ShiLt
	g	198bp	BALB/cJ, NOD/MrkTac

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24