D13Mit130 Primer Detail MGI Mouse MGI:706187

D13Mit130 Primer Detail

Name

D13Mit130
Primer 1 Sequence

TCTGCTGAAGGCCAGGAC
Primer 2 Sequence

TTTGAAGTGTCATGTTGATTTTAATG
ID

MGI:706187
Product Size

138
Other IDs

D13Mit130 (BROAD)
Note

MIT assay: MT251
Additional information: MIT STS Marker Data Files

DNA segment, Chr 13, Massachusetts Institute of Technology 130

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit130	c	149bp	C3HeB/FeJLe
	D13Mit130	f	smaller	FVB/N

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit130	c	148bp	CBA/CaOlaHsd
	D13Mit130	s	139bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13