About   Help   FAQ
D7Mit76 Primer Detail
Primers
  • Name
    D7Mit76
  • Primer 1 Sequence
    CATGAGCACGTGGAGAAAGA
  • Primer 2 Sequence
    CGTGGAAACCTGATAAACTGA
  • ID
    MGI:706200
  • Product Size
    225
  • Other IDs
    D7Mit76 (BROAD)
  • Note
    MIT assay: MPC2109
    Additional information: MIT STS Marker Data Files
Genes
D7Mit76 DNA segment, Chr 7, Massachusetts Institute of Technology 76
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D7Mit76 c 250bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit76 a 192bp CAST/EiJ
b 202bp AKR/J, NON/ShiLt
c 224bp BALB/cJ
d 226bp DBA/2J
e 228bp A/J, B6.Cg-Lepob/+, C57BL/6J
f 230bp SPRET/EiJ
g 250bp C3H/HeJ, LP/J, NOD/MrkTac
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D7Mit76 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit76 c 223bp CBA/CaOlaHsd
s 205bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory