D7Mit71 Primer Detail MGI Mouse MGI:706201

D7Mit71 Primer Detail

Name

D7Mit71
Primer 1 Sequence

CCACCTGGAATACATGTAACCC
Primer 2 Sequence

TAAGATCCAAGAGATGGGTTAAGC
ID

MGI:706201
Product Size

117
Note

MIT assay: B621

D7Mit71

DNA segment, Chr 7, Massachusetts Institute of Technology 71

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit71	a	112bp	A/J, NON/ShiLt
	b	114bp	C3H/HeJ
	c	116bp	AKR/J, BALB/cJ
	d	118bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	e	204bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D7Mit71	a	113bp	AKR/OlaHsd
	c	105bp	BALB/cJ
	d	115bp	129P3/J, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	h	111bp	C3H/HeJ
	j	95bp	JF1
	p	121bp	PWB
	w	109bp	A/JOlaHsd, SJL/J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit71	l	larger	LG/J
	D7Mit71	s	smaller	SM/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13