D4Mit37 Primer Detail MGI Mouse MGI:706207

D4Mit37 Primer Detail

Name

D4Mit37
Primer 1 Sequence

GGAAAGACAAACAGTAGTGTGGG
Primer 2 Sequence

TGCCATAACAACCATGGCTA
ID

MGI:706207
Product Size

236
Other IDs

D4Mit37 (BROAD)
Note

MIT assay: A709
Additional information: MIT STS Marker Data Files

D4Mit37

DNA segment, Chr 4, Massachusetts Institute of Technology 37

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D4Mit37	a	236bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	240bp	129X1/SvJ
		c	232, 236bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit37	b	larger	C57BL/6J
	D4Mit37	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit37	a	186bp	SPRET/EiJ
	b	220bp	A/J, DBA/2J, NON/ShiLt
	c	228bp	AKR/J
	d	232bp	BALB/cJ, C3H/HeJ
	e	234bp	CAST/EiJ
	f	236bp	NOD/MrkTac
	g	238bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit37	c	227bp	CBA/CaOlaHsd
	D4Mit37	s	213bp	SWR/OlaHsd

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit37	c	smaller	CBA/Kw
	D4Mit37	e	larger	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24