D10Mit20 Primer Detail MGI Mouse MGI:706215

D10Mit20 Primer Detail

Name

D10Mit20
Primer 1 Sequence

CACCCTCACACAGATATGCG
Primer 2 Sequence

GCATTGGGAAGTCCATGAGT
ID

MGI:706215
Product Size

234
Other IDs

D10Mit20 (BROAD)
Note

MIT assay: D638
Additional information: MIT STS Marker Data Files

D10Mit20

DNA segment, Chr 10, Massachusetts Institute of Technology 20

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit20	c	228bp	C3HeB/FeJLe
	D10Mit20	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit20	a	176bp	SPRET/EiJ
	b	186bp	CAST/EiJ
	c	226bp	BALB/cJ
	d	228bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NON/ShiLt
	e	230bp	NOD/MrkTac
	f	238bp	DBA/2J
	g	280bp	LP/J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit20	l	larger	LG/J
	D10Mit20	s	smaller	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit20	c	151bp	CBA/CaOlaHsd
	D10Mit20	s	154bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24