About   Help   FAQ
DXMit210 Primer Detail
Primers
  • Name
    DXMit210
  • Primer 1 Sequence
    GGGATAAAGTCTGAACTGTAGAAAGG
  • Primer 2 Sequence
    AATGATGATTACTGACTTGCTCTCC
  • ID
    MGI:706234
  • Product Size
    111
  • Other IDs
    DXMit210 (BROAD)
  • Note
    MIT assay: MTH2574
    Additional information: MIT STS Marker Data Files
Genes
DXMit210 DNA Segment, Chr X Massachusetts Institute of Technology 210
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit210 a 114bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
b 118bp SPRET/EiJ
c 124bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
d 140bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
DXMit210 a 124bp 129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W
b 114bp C57BL/6W, C57BL/10W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory