D14Mit93 Primer Detail MGI Mouse MGI:706244

D14Mit93 Primer Detail

Name

D14Mit93
Primer 1 Sequence

CCATCCCAACATGGATCC
Primer 2 Sequence

GCCTGGTGGACTGAACAAAT
ID

MGI:706244
Product Size

145
Other IDs

D14Mit93 (BROAD)
Note

MIT assay: MT384
Additional information: MIT STS Marker Data Files

D14Mit93

DNA segment, Chr 14, Massachusetts Institute of Technology 93

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit93	a	largest	JF1, MSM/Ms
Not Specified	D14Mit93	b	smaller	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit93	a	147bp	B6.Cg-Lep^ob/+
	D14Mit93	b	159bp	CAST/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24