D5Mit403 Primer Detail MGI Mouse MGI:706288

D5Mit403 Primer Detail

Name

D5Mit403
Primer 1 Sequence

GGCTCTAGCCATTCCATGTG
Primer 2 Sequence

CTCATGCTCACTCACCTCCA
ID

MGI:706288
Product Size

144
Other IDs

D5Mit403 (BROAD)
Note

MIT assay: MTH2343
Additional information: MIT STS Marker Data Files

D5Mit403

DNA Segment, Chr 5 Massachusetts Institute of Technology 403

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit403	a	136bp	A/J, BALB/cJ, CAST/EiJ, DBA/2J
	b	142bp	NON/ShiLt
	c	146bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D5Mit403	a	156bp	BN/aW
	b	146bp	129/SvW, AKR/W, C3H/W, C57BL/6W, C57BL/10W
	c	136bp	A.CA/W, BALB/cW, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24