About   Help   FAQ
D9Mit12 Primer Detail
Primers
  • Name
    D9Mit12
  • Primer 1 Sequence
    ATTCAAGGGGCAGTACACAT
  • Primer 2 Sequence
    TGGTCCTGGTAAAACTGCCT
  • ID
    MGI:706310
  • Product Size
    96
  • Other IDs
    D9Mit12 (BROAD)
  • Note
    MIT assay: M73
    Additional information: MIT STS Marker Data Files
Genes
D9Mit12 DNA segment, Chr 9, Massachusetts Institute of Technology 12
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D9Mit12 c 82bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit12 a 82bp A/J, BALB/cJ, C3H/HeJ
b 88bp AKR/J, DBA/2J
c 91bp NOD/MrkTac, NON/ShiLt
d 93bp B6.Cg-Lepob/+, C57BL/6J, LP/J
e 100bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D9Mit12 b 98bp 129P3/J, C57BL/6JOlaHsd, C57BL/10
c 86bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 90bp AKR/OlaHsd, DBA/2J
j 92bp JF1
p 94bp PWB, SJL/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D9Mit12 l larger LG/J
s smaller SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory