D9Mit15 Primer Detail MGI Mouse MGI:706313

D9Mit15 Primer Detail

Name

D9Mit15
Primer 1 Sequence

TTCAGTCCAGTCTGGGGGTA
Primer 2 Sequence

CCCCCAGTTTTGTTGTTTTG
ID

MGI:706313
Product Size

158
Note

MIT assay: M160

D9Mit15

DNA segment, Chr 9, Massachusetts Institute of Technology 15

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D9Mit15	b	not given	C57BL/6J
	c	155bp	C3HeB/FeJLe
	f	smallest	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit15	m	155bp	MOLF/EiJ
Not Specified	D9Mit15	s	200bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit15	a	131bp	SPRET/EiJ
	b	145bp	CAST/EiJ
	c	153bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	155bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	e	157bp	AKR/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24