D8Mit42 Primer Detail MGI Mouse MGI:706327

D8Mit42 Primer Detail

Name

D8Mit42
Primer 1 Sequence

ATTATCCCAAGGTGGCCTTC
Primer 2 Sequence

AGGGAACTCACGTTCACACC
ID

MGI:706327
Product Size

149
Other IDs

D8Mit42 (BROAD)
Note

MIT assay: A754
Additional information: MIT STS Marker Data Files

D8Mit42

DNA segment, Chr 8, Massachusetts Institute of Technology 42

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit42	c	144bp	C3HeB/FeJLe
	D8Mit42	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit42	a	138bp	CAST/EiJ
	b	144bp	A/J, AKR/J, BALB/cJ, C3H/HeJ
	c	148bp	LP/J
	d	150bp	DBA/2J
	e	152bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	f	168bp	SPRET/EiJ

J:66473 Bagella L, et al., J Cell Biochem. 2000 Apr;78(1):170-8

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit42	a	0.144kb	AEJ/Gn
	D8Mit42	s	0.168kb	M. spretus

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:66473 Bagella L, et al., Genomic organization, promoter analysis, and chromosomal mapping of the mouse gene encoding Cdk9. J Cell Biochem. 2000 Apr;78(1):170-8

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24