D8Mit46 Primer Detail MGI Mouse MGI:706330

D8Mit46 Primer Detail

Name

D8Mit46
Primer 1 Sequence

GCCTGGGCTACATGAGACTC
Primer 2 Sequence

GGGAATTCCAATACACTAAAGGG
ID

MGI:706330
Product Size

224
Other IDs

D8Mit46 (BROAD)
Note

MIT assay: B449
Additional information: MIT STS Marker Data Files

DNA segment, Chr 9, Massachusetts Institute of Technology 1000

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit1000	a	208bp	129X1/Sv
Not Specified	D9Mit1000	f	200, 208bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit1000	a	200bp	A/J, BALB/cJ, C3H/HeJ
	b	208bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	c	212bp	NON/ShiLt
	d	260bp	SPRET/EiJ
	e	280bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D9Mit1000	c	196bp	A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	222bp	129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
	j	244bp	JF1
	p	268bp	PWB

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24