D6Mit32 Primer Detail MGI Mouse MGI:706336

D6Mit32 Primer Detail

Name

D6Mit32
Primer 1 Sequence

CAGATAATTGTAGATTGCCCAGC
Primer 2 Sequence

CCCCTAGACTCCCAAAGGGTA
ID

MGI:706336
Product Size

207
Note

MIT assay: B340

D6Mit32

DNA segment, Chr 6, Massachusetts Institute of Technology 32

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit32	c	230bp	C3HeB/FeJLe
	D6Mit32	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit32	a	200bp	CAST/EiJ
	b	208bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J
	c	210bp	NON/ShiLt
	d	212bp	LP/J
	e	226bp	SPRET/EiJ
	f	230bp	C3H/HeJ, NOD/MrkTac

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 07/05/2024 MGI 6.24