D3Mit203 Primer Detail MGI Mouse MGI:706352

D3Mit203 Primer Detail

Name

D3Mit203
Primer 1 Sequence

CTGAATCCTTATGTCCACTGAGG
Primer 2 Sequence

GGGCACCTGCATTCATGT
ID

MGI:706352
Product Size

150
Other IDs

D3Mit203 (BROAD)
Note

MIT assay: MT3179
Additional information: MIT STS Marker Data Files

D3Mit203

DNA segment, Chr 3, Massachusetts Institute of Technology 203

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit203	a	138bp	129X1/Sv
Not Specified	D3Mit203	f	138, 146bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit203	c	138bp	C3HeB/FeJLe
	D3Mit203	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit203	a	124bp	SPRET/EiJ
	b	138bp	A/J, AKR/J, C3H/HeJ
	c	146bp	LP/J, NON/ShiLt
	d	148bp	DBA/2J
	e	150bp	NOD/MrkTac
	f	154bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	g	158bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit203	c	143bp	CBA/CaOlaHsd
	D3Mit203	s	148bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 07/02/2024 MGI 6.13