D3Mit200 Primer Detail MGI Mouse MGI:706355

D3Mit200 Primer Detail

Name

D3Mit200
Primer 1 Sequence

CAACTTCAGTTTCTCATTTGAATTG
Primer 2 Sequence

GCAAATGGAAGAGGTTTCTCC
ID

MGI:706355
Product Size

133
Other IDs

D3Mit200 (BROAD)
Note

MIT assay: MT2414
Additional information: MIT STS Marker Data Files

D3Mit200

DNA segment, Chr 3, Massachusetts Institute of Technology 200

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit200	a	127bp	129X1/Sv
Not Specified	D3Mit200	f	107, 127bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit200	a	99bp	CAST/EiJ
	b	107bp	DBA/2J, NOD/MrkTac
	c	115bp	AKR/J
	d	123bp	SPRET/EiJ
	e	127bp	BALB/cJ, LP/J
	f	129bp	NON/ShiLt
	g	131bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit200	c	148bp	CBA/CaOlaHsd
	D3Mit200	s	151bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24