D9Mit57 Primer Detail MGI Mouse MGI:706360

D9Mit57 Primer Detail

Name

D9Mit57
Primer 1 Sequence

TACAGCCACATATACACAAAACCA
Primer 2 Sequence

CTCACATCGCCCCATAGG
ID

MGI:706360
Product Size

165
Other IDs

D9Mit57 (BROAD)
Note

MIT assay: MPC1587
Additional information: MIT STS Marker Data Files

D9Mit57

DNA segment, Chr 9, Massachusetts Institute of Technology 57

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit57	c	164bp	C3HeB/FeJLe
	D9Mit57	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit57	a	164bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
	b	172bp	AKR/J, LP/J, NON/ShiLt
	c	194bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit57	a	172bp	AKR/W
	D9Mit57	b	164bp	129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24