D9Mit311 Primer Detail MGI Mouse MGI:706397

D9Mit311 Primer Detail

Name

D9Mit311
Primer 1 Sequence

CAGAAAACACTAATGTTTTGTATCTCA
Primer 2 Sequence

AGAAAACCACCTACCTACCTACACA
ID

MGI:706397
Product Size

140
Other IDs

D9Mit311 (BROAD)
Note

MIT assay: MTH1467
Additional information: MIT STS Marker Data Files

D9Mit311

DNA Segment, Chr 9, Massachusetts Institute of Technology 311

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit311	a	124bp	A/J, BALB/cJ, C3H/HeJ
	b	128bp	SPRET/EiJ
	c	134bp	CAST/EiJ
	d	142bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D9Mit311	c	120bp	A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	138bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
	g	104bp	129P3/J
	j	126bp	JF1
	p	114bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24