About   Help   FAQ
D9Mit198 Primer Detail
Primers
  • Name
    D9Mit198
  • Primer 1 Sequence
    TAGAATACTCACTTCAATGTCTCTTGC
  • Primer 2 Sequence
    ACTAGGCATACAAGTGTTATACACACA
  • ID
    MGI:706432
  • Product Size
    149
  • Other IDs
    D9Mit198 (BROAD)
  • Note
    MIT assay: MT2418
    Additional information: MIT STS Marker Data Files
Genes
D9Mit198 DNA segment, Chr 9, Massachusetts Institute of Technology 198
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit198 a 117bp CAST/EiJ
b 147bp LP/J, SPRET/EiJ
c 149bp A/J, BALB/cJ, DBA/2J, NON/ShiLt
d 150bp AKR/J, B6.Cg-Lepob/+
e 151bp C3H/HeJ, C57BL/6J
f 154bp NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit198 c 147bp CBA/CaOlaHsd
s 149bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory