About   Help   FAQ
D4Mit288 Primer Detail
Primers
  • Name
    D4Mit288
  • Primer 1 Sequence
    TATGCATTAGTCTAGGTGGTAACAGC
  • Primer 2 Sequence
    TTAGCCATGTAGGCAATGCA
  • ID
    MGI:706524
  • Product Size
    116
  • Other IDs
    D4Mit288 (BROAD)
  • Note
    MIT assay: MTH649
    Additional information: MIT STS Marker Data Files
Genes
D4Mit288 DNA segment, Chr 4, Massachusetts Institute of Technology 288
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit288 a 100bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
b 104bp NON/ShiLt
c 116bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
d 126bp SPRET/EiJ
e 136bp CAST/EiJ
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit288 c 0.135kb CAST/EiJ
w 0.12kb STOCK Whrnwi
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D4Mit288 a 116bp 129/SvW, BN/aW, C57BL/6W, C57BL/10W
b 100bp A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory