D4Mit288 Primer Detail MGI Mouse MGI:706524

D4Mit288 Primer Detail

Name

D4Mit288
Primer 1 Sequence

TATGCATTAGTCTAGGTGGTAACAGC
Primer 2 Sequence

TTAGCCATGTAGGCAATGCA
ID

MGI:706524
Product Size

116
Other IDs

D4Mit288 (BROAD)
Note

MIT assay: MTH649
Additional information: MIT STS Marker Data Files

D4Mit288

DNA segment, Chr 4, Massachusetts Institute of Technology 288

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit288	a	100bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	b	104bp	NON/ShiLt
	c	116bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	d	126bp	SPRET/EiJ
	e	136bp	CAST/EiJ

J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit288	c	0.135kb	CAST/EiJ
	D4Mit288	w	0.12kb	STOCK Whrn^wi

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit288	a	116bp	129/SvW, BN/aW, C57BL/6W, C57BL/10W
	D4Mit288	b	100bp	A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/29/2024 MGI 6.24