D6Mit275 Primer Detail MGI Mouse MGI:706531

D6Mit275 Primer Detail

Name

D6Mit275
Primer 1 Sequence

GGAGAACCCTGACTTTTTTGC
Primer 2 Sequence

ATGAAAGGTATTTTCAATACTCCACC
ID

MGI:706531
Product Size

125
Other IDs

D6Mit275 (BROAD)
Note

MIT assay: MT4523
Additional information: MIT STS Marker Data Files

D6Mit275

DNA segment, Chr 6, Massachusetts Institute of Technology 275

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit275	a	119bp	A/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	121bp	CAST/EiJ
	c	123bp	SPRET/EiJ
	d	125bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	131bp	AKR/J, BALB/cJ
	f	137bp	LP/J

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit275	b	lower	C57BL/6J
	D6Mit275	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24