About   Help   FAQ
DXMit144 Primer Detail
Primers
  • Name
    DXMit144
  • Primer 1 Sequence
    CCACGAAGCACAGAAGCAG
  • Primer 2 Sequence
    GAACATTTTAACATGCAATCTGTACC
  • ID
    MGI:706560
  • Product Size
    124
  • Other IDs
    DXMit144 (BROAD)
  • Note
    MIT assay: MJ4284
    Additional information: MIT STS Marker Data Files
Genes
DXMit144 DNA segment, Chr X, Massachusetts Institute of Technology 144
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit144 a 110bp CAST/EiJ
b 116bp SPRET/EiJ
c 118bp A/J, BALB/cJ, C3H/HeJ, DBA/2J
d 124bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
DXMit144 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory