D14Mit14 Primer Detail MGI Mouse MGI:706591

D14Mit14 Primer Detail

Name

D14Mit14
Primer 1 Sequence

GCACATTCCAAAACACATGC
Primer 2 Sequence

GGGATGGTGTCAATCAATCC
ID

MGI:706591
Product Size

243
Other IDs

D14Mit14 (BROAD)
Note

MIT assay: D603
Additional information: MIT STS Marker Data Files

D14Mit14

DNA segment, Chr 14, Massachusetts Institute of Technology 14

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit14	m	194bp	MOLF/EiJ
Not Specified	D14Mit14	s	184bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit14	a	248bp	A/J, BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
	b	270bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	c	274bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit14	a	270bp	C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	D14Mit14	b	248bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13