D8Mit309 Primer Detail MGI Mouse MGI:706595

D8Mit309 Primer Detail

Name

D8Mit309
Primer 1 Sequence

GAATTTGGGGAAATAGTGTCTCC
Primer 2 Sequence

CTCAGCCCTGAGTTCCACTC
ID

MGI:706595
Product Size

116
Other IDs

D8Mit309 (BROAD)
Note

MIT assay: MTH1305
Additional information: MIT STS Marker Data Files

D8Mit309

DNA Segment, Chr 8, Massachusetts Institute of Technology 309

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit309	a	88bp	SPRET/EiJ
	b	94bp	AKR/J, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	106bp	CAST/EiJ
	d	120bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit309	a	120bp	BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	D8Mit309	b	94bp	129/SvW, A.CA/W, AKR/W, BALB/cW, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24