D5Mit168 Primer Detail MGI Mouse MGI:706608

D5Mit168 Primer Detail

Name

D5Mit168
Primer 1 Sequence

CAGGTGACAGTTGTTCTCTTCC
Primer 2 Sequence

CATGCATGAACACACATCACA
ID

MGI:706608
Product Size

150
Other IDs

D5Mit168 (BROAD)
Note

MIT assay: MT1049
Additional information: MIT STS Marker Data Files

D5Mit168

DNA segment, Chr 5, Massachusetts Institute of Technology 168

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit168	a	92bp	SPRET/EiJ
	b	110bp	C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	127bp	BALB/cJ
	d	147bp	A/J
	e	152bp	C57BL/6J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D5Mit168	a	152bp	129/SvW, C57BL/6W, C57BL/10W
	b	126bp	AKR/W
	c	110bp	A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 07/02/2024 MGI 6.13