D5Mit394 Primer Detail MGI Mouse MGI:706627

D5Mit394 Primer Detail

Name

D5Mit394
Primer 1 Sequence

TAGATGCTGCCTAACAATTAGTAAGT
Primer 2 Sequence

TGGGAATATTTTTTCAAGTGTCTC
ID

MGI:706627
Product Size

150
Other IDs

D5Mit394 (BROAD)
Note

MIT assay: MTH2652
Additional information: MIT STS Marker Data Files

D5Mit394

DNA Segment, Chr 5 Massachusetts Institute of Technology 394

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit394	a	114bp	A/J, AKR/J, BALB/cJ, DBA/2J, NOD/MrkTac
	b	126bp	SPRET/EiJ
	c	132bp	C3H/HeJ, CAST/EiJ, NON/ShiLt
	d	154bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D5Mit394	a	154bp	129/SvW, C57BL/6W, C57BL/10W
	b	132bp	BN/aW, C3H/W, CBA/W
	c	114bp	A.CA/W, AKR/W, BALB/cW, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24