D9Mit17 Primer Detail MGI Mouse MGI:706638

D9Mit17 Primer Detail

Name

D9Mit17
Primer 1 Sequence

GCCAAGGCTGTCTCTTAGCC
Primer 2 Sequence

GAGAGAAGGGTTCTGGGCAG
ID

MGI:706638
Product Size

156
Other IDs

D9Mit17 (BROAD)
Note

MIT assay: L19
Additional information: MIT STS Marker Data Files

D9Mit17

DNA segment, Chr 9, Massachusetts Institute of Technology 17

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit17	a	128bp	CAST/EiJ
	b	138bp	LP/J
	c	140bp	NON/ShiLt
	d	142bp	AKR/J, NOD/MrkTac, SPRET/EiJ
	e	153bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	f	158bp	A/J, BALB/cJ, C3H/HeJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit17	l	smaller	LG/J
	D9Mit17	s	larger	SM/J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit17	c	lower	CBA/Kw
	D9Mit17	e	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24