D5Mit233 Primer Detail MGI Mouse MGI:706679

D5Mit233 Primer Detail

Name

D5Mit233
Primer 1 Sequence

TCCCCTCTGATCTCCTCAGA
Primer 2 Sequence

CCTCCTAGAATACAATTCAATGTGG
ID

MGI:706679
Product Size

147
Other IDs

D5Mit233 (BROAD)
Note

MIT assay: MT2906
Additional information: MIT STS Marker Data Files

D5Mit233

DNA segment, Chr 5, Massachusetts Institute of Technology 233

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit233	b	smaller	C57BL/6J
	D5Mit233	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit233	a	134bp	SPRET/EiJ
	b	147bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	c	154bp	CAST/EiJ
	d	168bp	DBA/2J
	e	176bp	BALB/cJ
	f	180bp	A/J, AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13