About   Help   FAQ
D7Mit227 Primer Detail
Primers
  • Name
    D7Mit227
  • Primer 1 Sequence
    GAGTCCTCAGCAGATATTACTCAGC
  • Primer 2 Sequence
    CTGATGTCTCATCATTTGGGG
  • ID
    MGI:706705
  • Product Size
    90
  • Other IDs
    D7Mit227 (BROAD)
  • Note
    MIT assay: MT3298
    Additional information: MIT STS Marker Data Files
Genes
D7Mit227 DNA segment, Chr 7, Massachusetts Institute of Technology 227
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit227 a 84bp AKR/J, LP/J, NOD/MrkTac
b 90bp B6.Cg-Lepob/+, SPRET/EiJ
c 92bp C57BL/6J, CAST/EiJ
d 102bp A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
e 108bp DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D7Mit227 a 80bp AKR/OlaHsd
b 88bp C57BL/6JOlaHsd, C57BL/10
c 98bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
d 104bp DBA/2J, JF1
p 76bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory