About   Help   FAQ
D1Mit234 Primer Detail
Primers
  • Name
    D1Mit234
  • Primer 1 Sequence
    TCCATTATTCCCAGAACCCA
  • Primer 2 Sequence
    TCAATGTTATTTTTTGCATCTGTG
  • ID
    MGI:706740
  • Product Size
    145
  • Other IDs
    D1Mit234 (BROAD)
  • Note
    MIT assay: MTH170
    Additional information: MIT STS Marker Data Files
Genes
D1Mit234 DNA segment, Chr 1, Massachusetts Institute of Technology 234
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit234 a 131bp CAST/EiJ
b 141bp A/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
c 143bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, NOD/MrkTac
d 145bp C57BL/6J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D1Mit234 c 145bp AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10
d 143bp 129P3/J, A/JOlaHsd, C3H/HeJ, DBA/2J, SJL/J
p 173bp JF1, PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory