D1Mit234 Primer Detail MGI Mouse MGI:706740

D1Mit234 Primer Detail

Name

D1Mit234
Primer 1 Sequence

TCCATTATTCCCAGAACCCA
Primer 2 Sequence

TCAATGTTATTTTTTGCATCTGTG
ID

MGI:706740
Product Size

145
Other IDs

D1Mit234 (BROAD)
Note

MIT assay: MTH170
Additional information: MIT STS Marker Data Files

D1Mit234

DNA segment, Chr 1, Massachusetts Institute of Technology 234

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit234	a	131bp	CAST/EiJ
	b	141bp	A/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
	c	143bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, NOD/MrkTac
	d	145bp	C57BL/6J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D1Mit234	c	145bp	AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10
	d	143bp	129P3/J, A/JOlaHsd, C3H/HeJ, DBA/2J, SJL/J
	p	173bp	JF1, PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24