D11Mit20 Primer Detail MGI Mouse MGI:706751

D11Mit20 Primer Detail

Name

D11Mit20
Primer 1 Sequence

CCTGTCCAGGTTTGAGAGGA
Primer 2 Sequence

CTTGGGAGCCTCTTCGGT
ID

MGI:706751
Product Size

114
Other IDs

D11Mit20 (BROAD)
Note

MIT assay: A755
Additional information: MIT STS Marker Data Files

D11Mit20

DNA segment, Chr 11, Massachusetts Institute of Technology 20

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit20	a	150bp	129X1/Sv
Not Specified	D11Mit20	f	146bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D11Mit20	b	smallest	C57BL/6J
	c	150bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit20	a	116bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	126bp	CAST/EiJ
	c	140bp	AKR/J, DBA/2J, NOD/MrkTac
	d	150bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	e	160bp	NON/ShiLt

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24