About   Help   FAQ
D11Mit20 Primer Detail
Primers
  • Name
    D11Mit20
  • Primer 1 Sequence
    CCTGTCCAGGTTTGAGAGGA
  • Primer 2 Sequence
    CTTGGGAGCCTCTTCGGT
  • ID
    MGI:706751
  • Product Size
    114
  • Other IDs
    D11Mit20 (BROAD)
  • Note
    MIT assay: A755
    Additional information: MIT STS Marker Data Files
Genes
D11Mit20 DNA segment, Chr 11, Massachusetts Institute of Technology 20
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit20 a 150bp 129X1/Sv
f 146bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D11Mit20 b smallest C57BL/6J
c 150bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit20 a 116bp B6.Cg-Lepob/+, C57BL/6J
b 126bp CAST/EiJ
c 140bp AKR/J, DBA/2J, NOD/MrkTac
d 150bp A/J, BALB/cJ, C3H/HeJ, LP/J
e 160bp NON/ShiLt
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory