D12Mit30 Primer Detail MGI Mouse MGI:706756

D12Mit30 Primer Detail

Name

D12Mit30
Primer 1 Sequence

TATGTGACTGCAATCCCAGC
Primer 2 Sequence

ATGAACACATCATGCCCAGA
ID

MGI:706756
Product Size

107
Other IDs

D12Mit30 (BROAD)
Note

MIT assay: A663
Additional information: MIT STS Marker Data Files

D12Mit30

DNA segment, Chr 12, Massachusetts Institute of Technology 30

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit30	b	smaller	C57BL/6J
	D12Mit30	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit30	a	82bp	CAST/EiJ
	b	106bp	DBA/2J
	c	108bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	112bp	A/J, C3H/HeJ
	e	118bp	LP/J

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit30	b	lower	C57BL/6J
	D12Mit30	s	upper	129/Sv

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24